|   | einverted | 
Please help by correcting and extending the Wiki pages.
einverted finds inverted repeats (stem loops) in nucleotide sequences. It identifies regions of local alignment of the input sequence and its reverse complement that exceed a threshold score. The alignments may include a proportion of mismatches and gaps, which correspond to bulges in the stem loop. One or more sequences are read and a file with the sequence(s) (without gap characters) of the inverted repeat regions is written. It can find multiple inverted repeats in a sequence. Only non-overlapping matches are reported.
einverted uses dynamic programming and thus is guaranteed to find optimal, local alignments between the sequence and its reverse complement. Matched bases contribute positively to the score whereas gaps and mismatches are penalised. The score for a local alignment is the sum of the values of each match, minus penalties for mismatches and gap insertion. Any region whose score exceeds the threshold is reported. The gap penalty, match score and mismatch score, and the threshold score for reporting regions, are all user-specified.
| % einverted tembl:d00596 Find inverted repeats in nucleotide sequences Gap penalty [12]: Minimum score threshold [50]: Match score [3]: Mismatch score [-4]: Sanger Centre program inverted output file [d00596.inv]: File for sequence of regions of inverted repeats. [d00596.fasta]: | 
Go to the input files for this example
Go to the output files for this example
| 
Find inverted repeats in nucleotide sequences
Version: EMBOSS:6.6.0.0
   Standard (Mandatory) qualifiers:
  [-sequence]          seqall     Nucleotide sequence(s) filename and optional
                                  format, or reference (input USA)
   -gap                integer    [12] Gap penalty (Integer 0 or more)
   -threshold          integer    [50] Minimum score threshold (Integer 0 or
                                  more)
   -match              integer    [3] Match score (Integer 0 or more)
   -mismatch           integer    [-4] Mismatch score (Integer up to 0)
  [-outfile]           outfile    [*.einverted] Sanger Centre program inverted
                                  output file
  [-outseq]            seqout     [ | 
| Qualifier | Type | Description | Allowed values | Default | 
|---|---|---|---|---|
| Standard (Mandatory) qualifiers | ||||
| [-sequence] (Parameter 1) | seqall | Nucleotide sequence(s) filename and optional format, or reference (input USA) | Readable sequence(s) | Required | 
| -gap | integer | Gap penalty | Integer 0 or more | 12 | 
| -threshold | integer | Minimum score threshold | Integer 0 or more | 50 | 
| -match | integer | Match score | Integer 0 or more | 3 | 
| -mismatch | integer | Mismatch score | Integer up to 0 | -4 | 
| [-outfile] (Parameter 2) | outfile | Sanger Centre program inverted output file | Output file | <*>.einverted | 
| [-outseq] (Parameter 3) | seqout | The sequence of the inverted repeat regions without gap characters. | Writeable sequence | <*>.format | 
| Additional (Optional) qualifiers | ||||
| -maxrepeat | integer | Maximum separation between the start of repeat and the end of the inverted repeat. | Integer 0 or more | 2000 | 
| Advanced (Unprompted) qualifiers | ||||
| (none) | ||||
| Associated qualifiers | ||||
| "-sequence" associated seqall qualifiers | ||||
| -sbegin1 -sbegin_sequence | integer | Start of each sequence to be used | Any integer value | 0 | 
| -send1 -send_sequence | integer | End of each sequence to be used | Any integer value | 0 | 
| -sreverse1 -sreverse_sequence | boolean | Reverse (if DNA) | Boolean value Yes/No | N | 
| -sask1 -sask_sequence | boolean | Ask for begin/end/reverse | Boolean value Yes/No | N | 
| -snucleotide1 -snucleotide_sequence | boolean | Sequence is nucleotide | Boolean value Yes/No | N | 
| -sprotein1 -sprotein_sequence | boolean | Sequence is protein | Boolean value Yes/No | N | 
| -slower1 -slower_sequence | boolean | Make lower case | Boolean value Yes/No | N | 
| -supper1 -supper_sequence | boolean | Make upper case | Boolean value Yes/No | N | 
| -scircular1 -scircular_sequence | boolean | Sequence is circular | Boolean value Yes/No | N | 
| -squick1 -squick_sequence | boolean | Read id and sequence only | Boolean value Yes/No | N | 
| -sformat1 -sformat_sequence | string | Input sequence format | Any string | |
| -iquery1 -iquery_sequence | string | Input query fields or ID list | Any string | |
| -ioffset1 -ioffset_sequence | integer | Input start position offset | Any integer value | 0 | 
| -sdbname1 -sdbname_sequence | string | Database name | Any string | |
| -sid1 -sid_sequence | string | Entryname | Any string | |
| -ufo1 -ufo_sequence | string | UFO features | Any string | |
| -fformat1 -fformat_sequence | string | Features format | Any string | |
| -fopenfile1 -fopenfile_sequence | string | Features file name | Any string | |
| "-outfile" associated outfile qualifiers | ||||
| -odirectory2 -odirectory_outfile | string | Output directory | Any string | |
| "-outseq" associated seqout qualifiers | ||||
| -osformat3 -osformat_outseq | string | Output seq format | Any string | |
| -osextension3 -osextension_outseq | string | File name extension | Any string | |
| -osname3 -osname_outseq | string | Base file name | Any string | |
| -osdirectory3 -osdirectory_outseq | string | Output directory | Any string | |
| -osdbname3 -osdbname_outseq | string | Database name to add | Any string | |
| -ossingle3 -ossingle_outseq | boolean | Separate file for each entry | Boolean value Yes/No | N | 
| -oufo3 -oufo_outseq | string | UFO features | Any string | |
| -offormat3 -offormat_outseq | string | Features format | Any string | |
| -ofname3 -ofname_outseq | string | Features file name | Any string | |
| -ofdirectory3 -ofdirectory_outseq | string | Output directory | Any string | |
| General qualifiers | ||||
| -auto | boolean | Turn off prompts | Boolean value Yes/No | N | 
| -stdout | boolean | Write first file to standard output | Boolean value Yes/No | N | 
| -filter | boolean | Read first file from standard input, write first file to standard output | Boolean value Yes/No | N | 
| -options | boolean | Prompt for standard and additional values | Boolean value Yes/No | N | 
| -debug | boolean | Write debug output to program.dbg | Boolean value Yes/No | N | 
| -verbose | boolean | Report some/full command line options | Boolean value Yes/No | Y | 
| -help | boolean | Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose | Boolean value Yes/No | N | 
| -warning | boolean | Report warnings | Boolean value Yes/No | Y | 
| -error | boolean | Report errors | Boolean value Yes/No | Y | 
| -fatal | boolean | Report fatal errors | Boolean value Yes/No | Y | 
| -die | boolean | Report dying program messages | Boolean value Yes/No | Y | 
| -version | boolean | Report version number and exit | Boolean value Yes/No | N | 
| 
ID   D00596; SV 1; linear; genomic DNA; STD; HUM; 18596 BP.
XX
AC   D00596;
XX
DT   17-JUL-1991 (Rel. 28, Created)
DT   07-DEC-2007 (Rel. 94, Last updated, Version 6)
XX
DE   Homo sapiens gene for thymidylate synthase, complete cds.
XX
KW   .
XX
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
XX
RN   [1]
RP   1-18596
RX   PUBMED; 2243092.
RA   Kaneda S., Nalbantoglu J., Takeishi K., Shimizu K., Gotoh O., Seno T.,
RA   Ayusawa D.;
RT   "Structural and functional analysis of the human thymidylate synthase
RT   gene";
RL   J Biol Chem 265(33):20277-20284(1990).
XX
DR   Ensembl-Gn; ENSG00000176890; Homo_sapiens.
DR   Ensembl-Tr; ENST00000323274; Homo_sapiens.
DR   GDB; 163670.
DR   GDB; 182340.
XX
CC   These data kindly submitted in computer readable form by:
CC   Sumiko Kaneda
CC   National Institute of Genetics
CC   1111 Yata
CC   Mishima 411
CC   Japan
XX
FH   Key             Location/Qualifiers
FH
FT   source          1..18596
FT                   /organism="Homo sapiens"
FT                   /chromosome="18"
FT                   /map="18p11.32"
FT                   /mol_type="genomic DNA"
FT                   /clone="lambdaHTS-1 and lambdaHTS-3"
FT                   /db_xref="taxon:9606"
FT   repeat_region   1..148
FT                   /rpt_family="Alu"
FT   repeat_region   202..477
FT                   /rpt_family="Alu"
  [Part of this file has been deleted for brevity]
     ttttgttttt agcttcagcg agaacccaga cctttcccaa agctcaggat tcttcgaaaa     15660
     gttgagaaaa ttgatgactt caaagctgaa gactttcaga ttgaagggta caatccgcat     15720
     ccaactatta aaatggaaat ggctgtttag ggtgctttca aaggagctcg aaggatattg     15780
     tcagtcttta ggggttgggc tggatgccga ggtaaaagtt ctttttgctc taaaagaaaa     15840
     aggaactagg tcaaaaatct gtccgtgacc tatcagttat taatttttaa ggatgttgcc     15900
     actggcaaat gtaactgtgc cagttctttc cataataaaa ggctttgagt taactcactg     15960
     agggtatctg acaatgctga ggttatgaac aaagtgagga gaatgaaatg tatgtgctct     16020
     tagcaaaaac atgtatgtgc atttcaatcc cacgtactta taaagaaggt tggtgaattt     16080
     cacaagctat ttttggaata tttttagaat attttaagaa tttcacaagc tattccctca     16140
     aatctgaggg agctgagtaa caccatcgat catgatgtag agtgtggtta tgaactttaa     16200
     agttatagtt gttttatatg ttgctataat aaagaagtgt tctgcattcg tccacgcttt     16260
     gttcattctg tactgccact tatctgctca gttccttcct aaaatagatt aaagaactct     16320
     ccttaagtaa acatgtgctg tattctggtt tggatgctac ttaaaagagt atattttaga     16380
     aataatagtg aatatatttt gccctatttt tctcatttta actgcatctt atcctcaaaa     16440
     tataatgacc atttaggata gagttttttt tttttttttt taaactttta taaccttaaa     16500
     gggttatttt aaaataatct atggactacc attttgccct cattagcttc agcatggtgt     16560
     gacttctcta ataatatgct tagattaagc aaggaaaaga tgcaaaacca cttcggggtt     16620
     aatcagtgaa atatttttcc cttcgttgca taccagatac ccccggtgtt gcacgactat     16680
     ttttattctg ctaatttatg acaagtgtta aacagaacaa ggaattattc caacaagtta     16740
     tgcaacatgt tgcttatttt caaattacag tttaatgtct aggtgccagc ccttgatata     16800
     gctatttttg taagaacatc ctcctggact ttgggttagt taaatctaaa cttatttaag     16860
     gattaagtag gataacgtgc attgatttgc taaaagaatc aagtaataat tacttagctg     16920
     attcctgagg gtggtatgac ttctagctga actcatcttg atcggtagga ttttttaaat     16980
     ccatttttgt aaaactattt ccaagaaatt ttaagccctt tcacttcaga aagaaaaaag     17040
     ttgttggggc tgagcactta attttcttga gcaggaagga gtttcttcca aacttcacca     17100
     tctggagact ggtgtttctt tacagattcc tccttcattt ctgttgagta gccgggatcc     17160
     tatcaaagac caaaaaaatg agtcctgtta acaaccacct ggaacaaaaa cagattttat     17220
     gcatttatgc tgctccaaga aatgctttta cgtctaagcc agaggcaatt aattaatttt     17280
     tttttttttg acatggagtc actgtccgtt gcccaggctg cagtgcagtg gcgcaatctt     17340
     ggctcactgc aacctccacc tcccaggttc aagtgattct cctgcctcag cctcccatgt     17400
     agctgggatc acaggcacct gccaccatgc ccggctaatt ttttgtattt tttgtagaga     17460
     cagggtttca ccatgttggc caggctggtc tcaaacacct gacctcaaat gatccacctg     17520
     cctcagcctc ccaaagtgtt gggattacag gcgtaagcca ccatgcccag ccctgaatta     17580
     atatttttaa aataagtttg gagactgttg gaaataatag ggcagaggaa catattttac     17640
     tggctacttg ccagagttag ttaactcatc aaactctttg ataatagttt gacctctgtt     17700
     ggtgaaaatg agccatgatc tcttgaacat gatcagaata aatgccccag ccacacaatt     17760
     gtagtccaaa ctttttaggt cactaacttg ctagatggtg ccaggttttt ttgcacaagg     17820
     agtgcaaatg ttaagatctc cactagtgag gaaaggctag tattacagaa gccttgtcag     17880
     aggcaattga acctccaagc cctggccctc aggcctgagg attttgatac agacaaactg     17940
     aagaaccgtt tgttagtgga tattgcaaac aaacaggagt caaagcttgg tgctccacag     18000
     tctagttcac gagacaggcg tggcagtggc tggcagcatc tcttctcaca ggggccctca     18060
     ggcacagctt accttgggag gcatgtagga agcccgctgg atcatcacgg gatacttgaa     18120
     atgctcatgc aggtggtcaa catactcaca caccctagga ggagggaatc agatcggggc     18180
     aatgatgcct gaagtcagat tattcacgtg gtgctaactt aaagcagaag gagcgagtac     18240
     cactcaattg acagtgttgg ccaaggctta gctgtgttac catgcgtttc taggcaagtc     18300
     cctaaacctc tgtgcctcag gtccttttct tctaaaatat agcaatgtga ggtggggact     18360
     ttgatgacat gaacacacga agtccctctg agaggttttg tggtgccctt taaaagggat     18420
     caattcagac tctgtaaata tccagaatta tttgggttcc tctggtcaaa agtcagatga     18480
     atagattaaa atcaccacat tttgtgatct atttttcaag aagcgtttgt attttttcat     18540
     atggctgcag cagctgccag gggcttgggg tttttttggc aggtagggtt gggagg         18596
//
 | 
| >D00596_13_142 gctacgcgagaggctgaggcagcagaattacttgaacccaggaggcggaggttgcagtga gccgagatcgcgccactgcactccagcctgggtgagagagcgagactctgtctcaaaaaa aaaaaaaaaa >D00596_199_328 ttttttttttttttttttgggacagtcttgctctgtcgcccaggctggagtacaatggtc ggatcttggctcactgcaacctctgcctcccaggttcaagcaattcttctgcctcagcct cccaagtagc >D00596_12128_12301 agaggatttttttttttttttttttttttgagacagagttttgctctgttgcccaggctg gaatgcaacggcgtgatcttggctcactgtaacctctgcctcctgggttcgagtgattct cctgcctcagcctccaagtagctgggattacagcatgtgccaccatgcctggct >D00596_12573_12749 agccaggtgtggtggctcacacctgtaattccaacaactccagaggccaaggcgagagga tcatttgaacccacggaatttgaggctgtagtgagtcatgatcacgccattgcactccat cctgggcaacagagtgagaccctgaatatttaaaaacaacaacaacaacaaaactct >D00596_12246_12296 ctcctgcctcagcctccaagtagctgggattacagcatgtgccaccatgcc >D00596_13886_13938 ggtatggtggctcatgcctgtaatcccagcactttggaagactgagacaggag >D00596_13884_13949 tgggtatggtggctcatgcctgtaatcccagcactttggaagactgagacaggagcaatt gcttga >D00596_14628_14692 tcaagcaattcttctgcctcagcctcccaggtagctgggattacaggcacatgccaccac accca | 
| 
D00596: Score 236: 108/130 ( 83%) matches, 0 gaps
      13 gctacgcgagaggctgaggcagcagaattacttgaacccaggaggcggaggttgcagtgagccgagatcgcgccactgcactccagcctgggtgagagagcgagactctgtctcaaaaaaaaaaaaaaaa 142     
         |||||  | ||||||||||||| |||||| ||||||||  |||||| |||||||||||||||| |||||   ||| || ||||||||||||| || ||||| ||||| |  |  ||||||||||||||||
     328 cgatgaaccctccgactccgtcttcttaacgaacttggaccctccgtctccaacgtcactcggttctaggctggtaacatgaggtcggacccgctgtctcgttctgacagggtttttttttttttttttt 199     
D00596: Score 164: 128/174 ( 73%) matches, 3 gaps
   12128 agaggatttttttttttttttttttttttgagacagagttttgctctgttgcccaggctggaatgcaacggcgtgatcttggctcactgtaacctctgcctcc-tgggttcgagtgattctcctgcctcagcctc-caagtagctgggattaca-gcatgtgccaccatgcctggct 12301   
         ||||  || || || || || |||||    |  ||| || |  |||||||||||||| |||| ||||| ||||||||| || ||||||  | ||||    ||| ||||||| | |||| |||  ||||  |||||   ||| | ||| |||||| |  || |||||||  |||||||
   12749 tctcaaaacaacaacaacaacaaaaatttataagtcccagagtgagacaacgggtcctacctcacgttaccgcactagtactgagtgatgtcggagtttaaggcacccaagtttactaggagagcggaaccggagacctcaacaaccttaatgtccacactcggtggtgtggaccga 12573   
D00596: Score 80: 44/51 ( 86%) matches, 2 gaps
   12246 ctcctgcctcag-cctccaagtagctgggattaca-gcatgtgccaccatgcc 12296   
         |||||| ||||| | |||||   |||||||||||| ||||| |||||||| ||
   13938 gaggacagagtcagaaggtttcacgaccctaatgtccgtactcggtggtatgg 13886   
D00596: Score 99: 53/65 ( 81%) matches, 1 gaps
   13884 tgggtatggtggctcatgcctgtaatcccagcactttggaagactgagacaggagcaattgcttga 13949   
         ||||| |||||||   ||||||||||||||||    ||| || ||||| ||| || ||||||||||
   14692 acccacaccaccgtacacggacattagggtcgatggaccctccgactccgtcttc-ttaacgaact 14628   
 | 
The original "inverted" program (from which einverted was derived) was used to annotate the nematode genome. Excluding overlapping repeats saved problems with simple repeat sequences in this genome.
einverted will find optimal alignments but is slower than heuristic methods such as BLAST.
Sometimes you can find repeats using the program palindrome that you can't find with einverted using the default parameters.This is not due to a problem with either program. It is simply because some of the shortest repeats that you find with palindrome's default parameter values are below einverted's default cutoff score - you should decrease the 'Minimum score threshold' to see them.
For example, when palindrome is run with 'em:x65921', it finds the repeat:
64    aaaactaaggc    74
      |||||||||||
98    ttttgattccg    88
einverted will not report this as its score is 33 (11 bases scoring 3 each, no mismatches or gaps) which is below the default score cutoff of 50.
If einverted is run as:
% einverted em:x65921 -threshold 30
then it will find it:
Score 33: 11/11 (100%) matches, 0 gaps
      64 aaaactaaggc 74      
         |||||||||||
      98 ttttgattccg 88      
Anything can be considered to be a repeat if you set the score threshold low enough!
einverted does not report overlapping matches.
| Program name | Description | 
|---|---|
| banana | Plot bending and curvature data for B-DNA | 
| btwisted | Calculate the twisting in a B-DNA sequence | 
| equicktandem | Find tandem repeats in nucleotide sequences | 
| etandem | Find tandem repeats in a nucleotide sequence | 
| palindrome | Find inverted repeats in nucleotide sequence(s) | 
| sirna | Find siRNA duplexes in mRNA | 
Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.
This application was modified for inclusion in EMBOSS by 
Peter Rice
European Bioinformatics Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SD, UK
Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.