|   | extractalign | 
Please help by correcting and extending the Wiki pages.
Extract the region from position 10 to 20:
| % extractalign dna.msf result.seq -regions "11-30" Extract regions from a sequence alignment | 
Go to the input files for this example
Go to the output files for this example
| 
Extract regions from a sequence alignment
Version: EMBOSS:6.6.0.0
   Standard (Mandatory) qualifiers:
  [-sequence]          seqset     (Aligned) sequence set filename and optional
                                  format, or reference (input USA)
   -regions            range      [Whole sequence] Regions to extract.
                                  A set of regions is specified by a set of
                                  pairs of positions.
                                  The positions are integers.
                                  They are separated by any non-digit,
                                  non-alpha character.
                                  Examples of region specifications are:
                                  24-45, 56-78
                                  1:45, 67=99;765..888
                                  1,5,8,10,23,45,57,99
  [-outseq]            seqoutall  [ | 
| Qualifier | Type | Description | Allowed values | Default | 
|---|---|---|---|---|
| Standard (Mandatory) qualifiers | ||||
| [-sequence] (Parameter 1) | seqset | (Aligned) sequence set filename and optional format, or reference (input USA) | Readable set of sequences | Required | 
| -regions | range | Regions to extract. A set of regions is specified by a set of pairs of positions. The positions are integers. They are separated by any non-digit, non-alpha character. Examples of region specifications are: 24-45, 56-78 1:45, 67=99;765..888 1,5,8,10,23,45,57,99 | Sequence range | Whole sequence | 
| [-outseq] (Parameter 2) | seqoutall | Sequence set(s) filename and optional format (output USA) | Writeable sequence(s) | <*>.format | 
| Additional (Optional) qualifiers | ||||
| (none) | ||||
| Advanced (Unprompted) qualifiers | ||||
| (none) | ||||
| Associated qualifiers | ||||
| "-sequence" associated seqset qualifiers | ||||
| -sbegin1 -sbegin_sequence | integer | Start of each sequence to be used | Any integer value | 0 | 
| -send1 -send_sequence | integer | End of each sequence to be used | Any integer value | 0 | 
| -sreverse1 -sreverse_sequence | boolean | Reverse (if DNA) | Boolean value Yes/No | N | 
| -sask1 -sask_sequence | boolean | Ask for begin/end/reverse | Boolean value Yes/No | N | 
| -snucleotide1 -snucleotide_sequence | boolean | Sequence is nucleotide | Boolean value Yes/No | N | 
| -sprotein1 -sprotein_sequence | boolean | Sequence is protein | Boolean value Yes/No | N | 
| -slower1 -slower_sequence | boolean | Make lower case | Boolean value Yes/No | N | 
| -supper1 -supper_sequence | boolean | Make upper case | Boolean value Yes/No | N | 
| -scircular1 -scircular_sequence | boolean | Sequence is circular | Boolean value Yes/No | N | 
| -squick1 -squick_sequence | boolean | Read id and sequence only | Boolean value Yes/No | N | 
| -sformat1 -sformat_sequence | string | Input sequence format | Any string | |
| -iquery1 -iquery_sequence | string | Input query fields or ID list | Any string | |
| -ioffset1 -ioffset_sequence | integer | Input start position offset | Any integer value | 0 | 
| -sdbname1 -sdbname_sequence | string | Database name | Any string | |
| -sid1 -sid_sequence | string | Entryname | Any string | |
| -ufo1 -ufo_sequence | string | UFO features | Any string | |
| -fformat1 -fformat_sequence | string | Features format | Any string | |
| -fopenfile1 -fopenfile_sequence | string | Features file name | Any string | |
| "-outseq" associated seqoutall qualifiers | ||||
| -osformat2 -osformat_outseq | string | Output seq format | Any string | |
| -osextension2 -osextension_outseq | string | File name extension | Any string | |
| -osname2 -osname_outseq | string | Base file name | Any string | |
| -osdirectory2 -osdirectory_outseq | string | Output directory | Any string | |
| -osdbname2 -osdbname_outseq | string | Database name to add | Any string | |
| -ossingle2 -ossingle_outseq | boolean | Separate file for each entry | Boolean value Yes/No | N | 
| -oufo2 -oufo_outseq | string | UFO features | Any string | |
| -offormat2 -offormat_outseq | string | Features format | Any string | |
| -ofname2 -ofname_outseq | string | Features file name | Any string | |
| -ofdirectory2 -ofdirectory_outseq | string | Output directory | Any string | |
| General qualifiers | ||||
| -auto | boolean | Turn off prompts | Boolean value Yes/No | N | 
| -stdout | boolean | Write first file to standard output | Boolean value Yes/No | N | 
| -filter | boolean | Read first file from standard input, write first file to standard output | Boolean value Yes/No | N | 
| -options | boolean | Prompt for standard and additional values | Boolean value Yes/No | N | 
| -debug | boolean | Write debug output to program.dbg | Boolean value Yes/No | N | 
| -verbose | boolean | Report some/full command line options | Boolean value Yes/No | Y | 
| -help | boolean | Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose | Boolean value Yes/No | N | 
| -warning | boolean | Report warnings | Boolean value Yes/No | Y | 
| -error | boolean | Report errors | Boolean value Yes/No | Y | 
| -fatal | boolean | Report fatal errors | Boolean value Yes/No | Y | 
| -die | boolean | Report dying program messages | Boolean value Yes/No | Y | 
| -version | boolean | Report version number and exit | Boolean value Yes/No | N | 
The input is a standard EMBOSS sequence query (also known as a 'USA').
Major sequence database sources defined as standard in EMBOSS installations include srs:embl, srs:uniprot and ensembl
Data can also be read from sequence output in any supported format written by an EMBOSS or third-party application.
The input format can be specified by using the command-line qualifier -sformat xxx, where 'xxx' is replaced by the name of the required format. The available format names are: gff (gff3), gff2, embl (em), genbank (gb, refseq), ddbj, refseqp, pir (nbrf), swissprot (swiss, sw), dasgff and debug.
See: http://emboss.sf.net/docs/themes/SequenceFormats.html for further information on sequence formats.
| 
!!NA_MULTIPLE_ALIGNMENT
 dna.msf  MSF: 120  Type: N  January 01, 1776  12:00  Check: 3196 ..
 Name: MSFM1          Len:   120  Check:  8587  Weight:  1.00
 Name: MSFM2          Len:   120  Check:  6178  Weight:  1.00
 Name: MSFM3          Len:   120  Check:  8431  Weight:  1.00
//
        MSFM1  ACGTACGTAC GTACGTACGT ACGTACGTAC GTACGTACGT ACGTACGTAC
        MSFM2  ACGTACGTAC GTACGTACGT ....ACGTAC GTACGTACGT ACGTACGTAC
        MSFM3  ACGTACGTAC GTACGTACGT ACGTACGTAC GTACGTACGT CGTACGTACG
        MSFM1  GTACGTACGT ACGTACGTAC GTACGTACGT ACGTACGTAC GTACGTACGT
        MSFM2  GTACGTACGT ACGTACGTAC GTACGTACGT ACGTACGTAC GTACGTACGT
        MSFM3  TACGTACGTA CGTACGTACG TACGTACGTA ACGTACGTAC GTACGTACGT
        MSFM1  ACGTACGTAC GTACGTACGT
        MSFM2  ACGTACGTTG CAACGTACGT
        MSFM3  ACGTACGTAC GTACGTACGT
 | 
You can specify a file of ranges to extract by giving the '-regions' qualifier the value '@' followed by the name of the file containing the ranges. (eg: '-regions @myfile').
The format of the range file is:
An example range file is:
# this is my set of ranges 12 23 4 5 this is like 12-23, but smaller 67 10348 interesting region
| >MSFM1 GTACGTACGTACGTACGTAC >MSFM2 GTACGTACGT----ACGTAC >MSFM3 GTACGTACGTACGTACGTAC | 
If the option '-separate' is used then each specified region is written to the output file as a separate sequence. The name of the sequence is created from the name of the original sequence with the start and end positions of the range appended with underscore characters between them,
For example: "XYZ region 2 to 34" is written as: "XYZ_2_34"
| Program name | Description | 
|---|---|
| abiview | Display the trace in an ABI sequencer file | 
| aligncopy | Read and write alignments | 
| aligncopypair | Read and write pairs from alignments | 
| biosed | Replace or delete sequence sections | 
| codcopy | Copy and reformat a codon usage table | 
| coderet | Extract CDS, mRNA and translations from feature tables | 
| cutseq | Remove a section from a sequence | 
| degapseq | Remove non-alphabetic (e.g. gap) characters from sequences | 
| descseq | Alter the name or description of a sequence | 
| entret | Retrieve sequence entries from flatfile databases and files | 
| extractfeat | Extract features from sequence(s) | 
| extractseq | Extract regions from a sequence | 
| featcopy | Read and write a feature table | 
| featmerge | Merge two overlapping feature tables | 
| featreport | Read and write a feature table | 
| feattext | Return a feature table original text | 
| infoalign | Display basic information about a multiple sequence alignment | 
| infoseq | Display basic information about sequences | 
| listor | Write a list file of the logical OR of two sets of sequences | 
| makenucseq | Create random nucleotide sequences | 
| makeprotseq | Create random protein sequences | 
| maskambignuc | Mask all ambiguity characters in nucleotide sequences with N | 
| maskambigprot | Mask all ambiguity characters in protein sequences with X | 
| maskfeat | Write a sequence with masked features | 
| maskseq | Write a sequence with masked regions | 
| newseq | Create a sequence file from a typed-in sequence | 
| nohtml | Remove mark-up (e.g. HTML tags) from an ASCII text file | 
| noreturn | Remove carriage return from ASCII files | 
| nospace | Remove whitespace from an ASCII text file | 
| notab | Replace tabs with spaces in an ASCII text file | 
| notseq | Write to file a subset of an input stream of sequences | 
| nthseq | Write to file a single sequence from an input stream of sequences | 
| nthseqset | Read and write (return) one set of sequences from many | 
| pasteseq | Insert one sequence into another | 
| refseqget | Get reference sequence | 
| revseq | Reverse and complement a nucleotide sequence | 
| seqcount | Read and count sequences | 
| seqret | Read and write (return) sequences | 
| seqretsetall | Read and write (return) many sets of sequences | 
| seqretsplit | Read sequences and write them to individual files | 
| seqxref | Retrieve all database cross-references for a sequence entry | 
| seqxrefget | Retrieve all cross-referenced data for a sequence entry | 
| showalign | Display a multiple sequence alignment in pretty format | 
| sizeseq | Sort sequences by size | 
| skipredundant | Remove redundant sequences from an input set | 
| skipseq | Read and write (return) sequences, skipping first few | 
| splitsource | Split sequence(s) into original source sequences | 
| splitter | Split sequence(s) into smaller sequences | 
| trimest | Remove poly-A tails from nucleotide sequences | 
| trimseq | Remove unwanted characters from start and end of sequence(s) | 
| trimspace | Remove extra whitespace from an ASCII text file | 
| union | Concatenate multiple sequences into a single sequence | 
| variationget | Get sequence variations | 
| vectorstrip | Remove vectors from the ends of nucleotide sequence(s) | 
| whichdb | Search all sequence databases for an entry and retrieve it | 
| yank | Add a sequence reference (a full USA) to a list file | 
Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.