|   | featreport | 
Please help by correcting and extending the Wiki pages.
| % featreport Read and write a feature table Input sequence: paamir.fasta Input feature table: paamir.gff Output report [x13776.featreport]: test.out | 
Go to the input files for this example
Go to the output files for this example
| 
Read and write a feature table
Version: EMBOSS:6.6.0.0
   Standard (Mandatory) qualifiers:
  [-sequence]          sequence   Sequence filename and optional format, or
                                  reference (input USA)
  [-features]          features   (no help text) features value
  [-outfile]           report     [*.featreport] Output report file name
                                  (default -rformat gff)
   Additional (Optional) qualifiers: (none)
   Advanced (Unprompted) qualifiers: (none)
   Associated qualifiers:
   "-sequence" associated qualifiers
   -sbegin1            integer    Start of the sequence to be used
   -send1              integer    End of the sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -scircular1         boolean    Sequence is circular
   -squick1            boolean    Read id and sequence only
   -sformat1           string     Input sequence format
   -iquery1            string     Input query fields or ID list
   -ioffset1           integer    Input start position offset
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name
   "-features" associated qualifiers
   -fformat2           string     Features format
   -iquery2            string     Input query fields or ID list
   -ioffset2           integer    Input start position offset
   -fopenfile2         string     Features file name
   -fask2              boolean    Prompt for begin/end/reverse
   -fbegin2            integer    Start of the features to be used
   -fend2              integer    End of the features to be used
   -freverse2          boolean    Reverse (if DNA)
   -fcircular2         boolean    Circular sequence features
   "-outfile" associated qualifiers
   -rformat3           string     Report format
   -rname3             string     Base file name
   -rextension3        string     File name extension
   -rdirectory3        string     Output directory
   -raccshow3          boolean    Show accession number in the report
   -rdesshow3          boolean    Show description in the report
   -rscoreshow3        boolean    Show the score in the report
   -rstrandshow3       boolean    Show the nucleotide strand in the report
   -rusashow3          boolean    Show the full USA in the report
   -rmaxall3           integer    Maximum total hits to report
   -rmaxseq3           integer    Maximum hits to report for one sequence
   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options and exit. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages
   -version            boolean    Report version number and exit
 | 
| Qualifier | Type | Description | Allowed values | Default | 
|---|---|---|---|---|
| Standard (Mandatory) qualifiers | ||||
| [-sequence] (Parameter 1) | sequence | Sequence filename and optional format, or reference (input USA) | Readable sequence | Required | 
| [-features] (Parameter 2) | features | (no help text) features value | Readable feature table | Required | 
| [-outfile] (Parameter 3) | report | Output report file name | (default -rformat gff) | <*>.featreport | 
| Additional (Optional) qualifiers | ||||
| (none) | ||||
| Advanced (Unprompted) qualifiers | ||||
| (none) | ||||
| Associated qualifiers | ||||
| "-sequence" associated sequence qualifiers | ||||
| -sbegin1 -sbegin_sequence | integer | Start of the sequence to be used | Any integer value | 0 | 
| -send1 -send_sequence | integer | End of the sequence to be used | Any integer value | 0 | 
| -sreverse1 -sreverse_sequence | boolean | Reverse (if DNA) | Boolean value Yes/No | N | 
| -sask1 -sask_sequence | boolean | Ask for begin/end/reverse | Boolean value Yes/No | N | 
| -snucleotide1 -snucleotide_sequence | boolean | Sequence is nucleotide | Boolean value Yes/No | N | 
| -sprotein1 -sprotein_sequence | boolean | Sequence is protein | Boolean value Yes/No | N | 
| -slower1 -slower_sequence | boolean | Make lower case | Boolean value Yes/No | N | 
| -supper1 -supper_sequence | boolean | Make upper case | Boolean value Yes/No | N | 
| -scircular1 -scircular_sequence | boolean | Sequence is circular | Boolean value Yes/No | N | 
| -squick1 -squick_sequence | boolean | Read id and sequence only | Boolean value Yes/No | N | 
| -sformat1 -sformat_sequence | string | Input sequence format | Any string | |
| -iquery1 -iquery_sequence | string | Input query fields or ID list | Any string | |
| -ioffset1 -ioffset_sequence | integer | Input start position offset | Any integer value | 0 | 
| -sdbname1 -sdbname_sequence | string | Database name | Any string | |
| -sid1 -sid_sequence | string | Entryname | Any string | |
| -ufo1 -ufo_sequence | string | UFO features | Any string | |
| -fformat1 -fformat_sequence | string | Features format | Any string | |
| -fopenfile1 -fopenfile_sequence | string | Features file name | Any string | |
| "-features" associated features qualifiers | ||||
| -fformat2 -fformat_features | string | Features format | Any string | |
| -iquery2 -iquery_features | string | Input query fields or ID list | Any string | |
| -ioffset2 -ioffset_features | integer | Input start position offset | Any integer value | 0 | 
| -fopenfile2 -fopenfile_features | string | Features file name | Any string | |
| -fask2 -fask_features | boolean | Prompt for begin/end/reverse | Boolean value Yes/No | N | 
| -fbegin2 -fbegin_features | integer | Start of the features to be used | Any integer value | 0 | 
| -fend2 -fend_features | integer | End of the features to be used | Any integer value | 0 | 
| -freverse2 -freverse_features | boolean | Reverse (if DNA) | Boolean value Yes/No | N | 
| -fcircular2 -fcircular_features | boolean | Circular sequence features | Boolean value Yes/No | N | 
| "-outfile" associated report qualifiers | ||||
| -rformat3 -rformat_outfile | string | Report format | Any string | gff | 
| -rname3 -rname_outfile | string | Base file name | Any string | |
| -rextension3 -rextension_outfile | string | File name extension | Any string | |
| -rdirectory3 -rdirectory_outfile | string | Output directory | Any string | |
| -raccshow3 -raccshow_outfile | boolean | Show accession number in the report | Boolean value Yes/No | N | 
| -rdesshow3 -rdesshow_outfile | boolean | Show description in the report | Boolean value Yes/No | N | 
| -rscoreshow3 -rscoreshow_outfile | boolean | Show the score in the report | Boolean value Yes/No | Y | 
| -rstrandshow3 -rstrandshow_outfile | boolean | Show the nucleotide strand in the report | Boolean value Yes/No | Y | 
| -rusashow3 -rusashow_outfile | boolean | Show the full USA in the report | Boolean value Yes/No | N | 
| -rmaxall3 -rmaxall_outfile | integer | Maximum total hits to report | Any integer value | 0 | 
| -rmaxseq3 -rmaxseq_outfile | integer | Maximum hits to report for one sequence | Any integer value | 0 | 
| General qualifiers | ||||
| -auto | boolean | Turn off prompts | Boolean value Yes/No | N | 
| -stdout | boolean | Write first file to standard output | Boolean value Yes/No | N | 
| -filter | boolean | Read first file from standard input, write first file to standard output | Boolean value Yes/No | N | 
| -options | boolean | Prompt for standard and additional values | Boolean value Yes/No | N | 
| -debug | boolean | Write debug output to program.dbg | Boolean value Yes/No | N | 
| -verbose | boolean | Report some/full command line options | Boolean value Yes/No | Y | 
| -help | boolean | Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose | Boolean value Yes/No | N | 
| -warning | boolean | Report warnings | Boolean value Yes/No | Y | 
| -error | boolean | Report errors | Boolean value Yes/No | Y | 
| -fatal | boolean | Report fatal errors | Boolean value Yes/No | Y | 
| -die | boolean | Report dying program messages | Boolean value Yes/No | Y | 
| -version | boolean | Report version number and exit | Boolean value Yes/No | N | 
The input is a standard EMBOSS sequence query (also known as a 'USA') with associated feature information.
Major sequence database sources defined as standard in EMBOSS installations include srs:embl, srs:uniprot and ensembl
Data can also be read from sequence output in any supported format written by an EMBOSS or third-party application.
The input format can be specified by using the command-line qualifier -sformat xxx, where 'xxx' is replaced by the name of the required format. The available format names are: text, html, xml (uniprotxml), obo, embl (swissprot)
Where the sequence format has no feature information, a second file can be read to load the feature data. The file is specified with the qualifier -ufo xxx and the feature format is specified with the qualifier -fformat xxx
See: http://emboss.sf.net/docs/themes/SequenceFormats.html for further information on sequence formats.
See: http://emboss.sf.net/docs/themes/FeatureFormats.html for further information on feature formats.
| >X13776 X13776.1 Pseudomonas aeruginosa amiC and amiR gene for aliphatic amidase regulation ggtaccgctggccgagcatctgctcgatcaccaccagccgggcgacgggaactgcacgat ctacctggcgagcctggagcacgagcgggttcgcttcgtacggcgctgagcgacagtcac aggagaggaaacggatgggatcgcaccaggagcggccgctgatcggcctgctgttctccg aaaccggcgtcaccgccgatatcgagcgctcgcacgcgtatggcgcattgctcgcggtcg agcaactgaaccgcgagggcggcgtcggcggtcgcccgatcgaaacgctgtcccaggacc ccggcggcgacccggaccgctatcggctgtgcgccgaggacttcattcgcaaccgggggg tacggttcctcgtgggctgctacatgtcgcacacgcgcaaggcggtgatgccggtggtcg agcgcgccgacgcgctgctctgctacccgaccccctacgagggcttcgagtattcgccga acatcgtctacggcggtccggcgccgaaccagaacagtgcgccgctggcggcgtacctga ttcgccactacggcgagcgggtggtgttcatcggctcggactacatctatccgcgggaaa gcaaccatgtgatgcgccacctgtatcgccagcacggcggcacggtgctcgaggaaatct acattccgctgtatccctccgacgacgacttgcagcgcgccgtcgagcgcatctaccagg cgcgcgccgacgtggtcttctccaccgtggtgggcaccggcaccgccgagctgtatcgcg ccatcgcccgtcgctacggcgacggcaggcggccgccgatcgccagcctgaccaccagcg aggcggaggtggcgaagatggagagtgacgtggcagaggggcaggtggtggtcgcgcctt acttctccagcatcgatacgcccgccagccgggccttcgtccaggcctgccatggtttct tcccggagaacgcgaccatcaccgcctgggccgaggcggcctactggcagaccttgttgc tcggccgcgccgcgcaggccgcaggcaactggcgggtggaagacgtgcagcggcacctgt acgacatcgacatcgacgcgccacaggggccggtccgggtggagcgccagaacaaccaca gccgcctgtcttcgcgcatcgcggaaatcgatgcgcgcggcgtgttccaggtccgctggc agtcgcccgaaccgattcgccccgacccttatgtcgtcgtgcataacctcgacgactggt ccgccagcatgggcgggggaccgctcccatgagcgccaactcgctgctcggcagcctgcg cgagttgcaggtgctggtcctcaacccgccgggggaggtcagcgacgccctggtcttgca gctgatccgcatcggttgttcggtgcgccagtgctggccgccgccggaagccttcgacgt gccggtggacgtggtcttcaccagcattttccagaatggccaccacgacgagatcgctgc gctgctcgccgccgggactccgcgcactaccctggtggcgctggtggagtacgaaagccc cgcggtgctctcgcagatcatcgagctggagtgccacggcgtgatcacccagccgctcga tgcccaccgggtgctgcctgtgctggtatcggcgcggcgcatcagcgaggaaatggcgaa gctgaagcagaagaccgagcagctccaggaccgcatcgccggccaggcccggatcaacca ggccaaggtgttgctgatgcagcgccatggctgggacgagcgcgaggcgcaccagcacct gtcgcgggaagcgatgaagcggcgcgagccgatcctgaagatcgctcaggagttgctggg aaacgagccgtccgcctgagcgatccgggccgaccagaacaataacaagaggggtatcgt catcatgctgggactggttctgctgtacgttggcgcggtgctgtttctcaatgccgtctg gttgctgggcaagatcagcggtcgggaggtggcggtgatcaacttcctggtcggcgtgct gagcgcctgcgtcgcgttctacctgatcttttccgcagcagccgggcagggctcgctgaa ggccggagcgctgaccctgctattcgcttttacctatctgtgggtggccgccaaccagtt cctcgag | 
| ##gff-version 2.0 ##date 2003-02-14 ##Type DNA PAAMIR PAAMIR EMBL source 1 2167 0.000 + . Sequence "PAAMIR.1" ; db_xref "taxon:287" ; organism "Pseudomonas aeruginosa" ; strain "PAC" ; isolate "PAC 1" ; map "38 min" PAAMIR EMBL CDS 1289 1879 0.000 + . Sequence "PAAMIR.2" ; db_xref "SWISS-PROT:P10932" ; note "aliphatic amidase regulator, positive regulator of amiE" ; transl_table 11 ; gene "amiR" ; protein_id "CAA32023.1" ; translation "MSANSLLGSLRELQVLVLNPPGEVSDALVLQLIRIGCSVRQCWPPPEAFDVPVDVVFTSIFQNGHHDEIAALLAAGTPRTTLVALVEYESPAVLSQIIELECHGVITQPLDAHRVLPVLVSARRISEEMAKLKQKTEQLQDRIAGQARINQAKVLLMQRHGWDEREAHQHLSREAMKRREPILKIAQELLGNEPSA" PAAMIR EMBL CDS 135 1292 0.000 + . Sequence "PAAMIR.3" ; db_xref "SWISS-PROT:P27017" ; note "negative regulator of amiR" ; transl_table 11 ; gene "amiC" ; protein_id "CAA32024.1" ; translation "MGSHQERPLIGLLFSETGVTADIERSHAYGALLAVEQLNREGGVGGRPIETLSQDPGGDPDRYRLCAEDFIRNRGVRFLVGCYMSHTRKAVMPVVERADALLCYPTPYEGFEYSPNIVYGGPAPNQNSAPLAAYLIRHYGERVVFIGSDYIYPRESNHVMRHLYRQHGGTVLEEIYIPLYPSDDDLQRAVERIYQARADVVFSTVVGTGTAELYRAIARRYGDGRRPPIASLTTSEAEVAKMESDVAEGQVVVAPYFSSIDTPASRAFVQACHGFFPENATITAWAEAAYWQTLLLGRAAQAAGNWRVEDVQRHLYDIDIDAPQGPVRVERQNNHSRLSSRIAEIDARGVFQVRWQSPEPIRPDPYVVVHNLDDWSASMGGGPLP" PAAMIR EMBL promoter 8 24 0.000 + . Sequence "PAAMIR.4" ; note "proposed rpoN-dependent promoter" PAAMIR EMBL promoter 65 81 0.000 + . Sequence "PAAMIR.5" ; note "proposed rpoN-dependent promoter" PAAMIR EMBL RBS 121 126 0.000 + . Sequence "PAAMIR.6" ; note "proposed Shine-Dalgarno sequence" PAAMIR EMBL variation 912 1167 0.000 + . Sequence "PAAMIR.7" ; note "ClaI fragment deleted in pSW36, constitutive phenotype" ; replace "" ; gene "amiC" PAAMIR EMBL misc_feature 1 1 0.000 + . Sequence "PAAMIR.8" ; FeatFlags "0x40" ; note "last base of an XhoI site" PAAMIR EMBL misc_feature 648 653 0.000 + . Sequence "PAAMIR.9" ; note "end of 658bp XhoI fragment, deletion in pSW3 causes constitutive expression of amiE" PAAMIR EMBL conflict 1281 1281 0.000 + . Sequence "PAAMIR.10" ; FeatFlags "0x40" ; replace "g" ; citation [3] | 
The output is a standard EMBOSS report file.
The results can be output in one of several styles by using the command-line qualifier -rformat xxx, where 'xxx' is replaced by the name of the required format. The available format names are: embl, genbank, gff, pir, swiss, dasgff, debug, listfile, dbmotif, diffseq, draw, restrict, excel, feattable, motif, nametable, regions, seqtable, simple, srs, table, tagseq.
See: http://emboss.sf.net/docs/themes/ReportFormats.html for further information on report formats.
By default the report is in 'gff' feature format.
| ##gff-version 3 ##sequence-region PAAMIR 1 2167 #!Date 2013-07-15 #!Type DNA #!Source-version EMBOSS 6.6.0.0 PAAMIR EMBL databank_entry 1 2167 . + . ID=PAAMIR.1;db_xref=taxon:287;organism=Pseudomonas aeruginosa;strain=PAC;isolate=PAC 1;map=38 min PAAMIR EMBL CDS 1289 1879 . + 0 ID=PAAMIR.2;db_xref=SWISS-PROT:P10932;note=aliphatic amidase regulator%2C positive regulator of amiE;transl_table=11;gene=amiR;protein_id=CAA32023.1;translation=MSANSLLGSLRELQVLVLNPPGEVSDALVLQLIRIGCSVRQCWPPPEAFDVPVDVVFTSIFQNGHHDEIAALLAAGTPRTTLVALVEYESPAVLSQIIELECHGVITQPLDAHRVLPVLVSARRISEEMAKLKQKTEQLQDRIAGQARINQAKVLLMQRHGWDEREAHQHLSREAMKRREPILKIAQELLGNEPSA PAAMIR EMBL CDS 135 1292 . + 0 ID=PAAMIR.3;db_xref=SWISS-PROT:P27017;note=negative regulator of amiR;transl_table=11;gene=amiC;protein_id=CAA32024.1;translation=MGSHQERPLIGLLFSETGVTADIERSHAYGALLAVEQLNREGGVGGRPIETLSQDPGGDPDRYRLCAEDFIRNRGVRFLVGCYMSHTRKAVMPVVERADALLCYPTPYEGFEYSPNIVYGGPAPNQNSAPLAAYLIRHYGERVVFIGSDYIYPRESNHVMRHLYRQHGGTVLEEIYIPLYPSDDDLQRAVERIYQARADVVFSTVVGTGTAELYRAIARRYGDGRRPPIASLTTSEAEVAKMESDVAEGQVVVAPYFSSIDTPASRAFVQACHGFFPENATITAWAEAAYWQTLLLGRAAQAAGNWRVEDVQRHLYDIDIDAPQGPVRVERQNNHSRLSSRIAEIDARGVFQVRWQSPEPIRPDPYVVVHNLDDWSASMGGGPLP PAAMIR EMBL promoter 8 24 . + . ID=PAAMIR.4;note=proposed rpoN-dependent promoter PAAMIR EMBL promoter 65 81 . + . ID=PAAMIR.5;note=proposed rpoN-dependent promoter PAAMIR EMBL ribosome_entry_site 121 126 . + . ID=PAAMIR.6;note=proposed Shine-Dalgarno sequence PAAMIR EMBL sequence_variant 912 1167 . + . ID=PAAMIR.7;note=ClaI fragment deleted in pSW36%2C constitutive phenotype;replace=;gene=amiC PAAMIR EMBL sequence_feature 1 1 . + . ID=PAAMIR.8;note=last base of an XhoI site PAAMIR EMBL sequence_feature 648 653 . + . ID=PAAMIR.9;note=end of 658bp XhoI fragment%2C deletion in pSW3 causes constitutive expression of amiE PAAMIR EMBL sequence_conflict 1281 1281 . + . ID=PAAMIR.10;replace=g;citation=[3] | 
| Program name | Description | 
|---|---|
| aligncopy | Read and write alignments | 
| aligncopypair | Read and write pairs from alignments | 
| biosed | Replace or delete sequence sections | 
| codcopy | Copy and reformat a codon usage table | 
| cutseq | Remove a section from a sequence | 
| degapseq | Remove non-alphabetic (e.g. gap) characters from sequences | 
| descseq | Alter the name or description of a sequence | 
| entret | Retrieve sequence entries from flatfile databases and files | 
| extractalign | Extract regions from a sequence alignment | 
| extractfeat | Extract features from sequence(s) | 
| extractseq | Extract regions from a sequence | 
| featcopy | Read and write a feature table | 
| featmerge | Merge two overlapping feature tables | 
| feattext | Return a feature table original text | 
| listor | Write a list file of the logical OR of two sets of sequences | 
| makenucseq | Create random nucleotide sequences | 
| makeprotseq | Create random protein sequences | 
| maskambignuc | Mask all ambiguity characters in nucleotide sequences with N | 
| maskambigprot | Mask all ambiguity characters in protein sequences with X | 
| maskfeat | Write a sequence with masked features | 
| maskseq | Write a sequence with masked regions | 
| newseq | Create a sequence file from a typed-in sequence | 
| nohtml | Remove mark-up (e.g. HTML tags) from an ASCII text file | 
| noreturn | Remove carriage return from ASCII files | 
| nospace | Remove whitespace from an ASCII text file | 
| notab | Replace tabs with spaces in an ASCII text file | 
| notseq | Write to file a subset of an input stream of sequences | 
| nthseq | Write to file a single sequence from an input stream of sequences | 
| nthseqset | Read and write (return) one set of sequences from many | 
| pasteseq | Insert one sequence into another | 
| revseq | Reverse and complement a nucleotide sequence | 
| seqcount | Read and count sequences | 
| seqret | Read and write (return) sequences | 
| seqretsetall | Read and write (return) many sets of sequences | 
| seqretsplit | Read sequences and write them to individual files | 
| sizeseq | Sort sequences by size | 
| skipredundant | Remove redundant sequences from an input set | 
| skipseq | Read and write (return) sequences, skipping first few | 
| splitsource | Split sequence(s) into original source sequences | 
| splitter | Split sequence(s) into smaller sequences | 
| trimest | Remove poly-A tails from nucleotide sequences | 
| trimseq | Remove unwanted characters from start and end of sequence(s) | 
| trimspace | Remove extra whitespace from an ASCII text file | 
| union | Concatenate multiple sequences into a single sequence | 
| vectorstrip | Remove vectors from the ends of nucleotide sequence(s) | 
| yank | Add a sequence reference (a full USA) to a list file | 
Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.